Authors: Martina Hurtová; Daniela Brdová; Bára Křížkovská; Guglielmo Tedeschi; Tomáš Nejedlý; Ondřej Strnad; Simona Dobiasová; Zuzana Osifová; Gabriela Kroneislová; Jan Lipov; Kateřina Valentová; Jitka Viktorová; Vladimír Křen doi:10.1021/acsomega.4c04627
Abstract

In this work, we report the application of Buchwald–Hartwig amination for the preparation of new derivatives of quercetin and luteolin. Our investigation delves into the impact of aniline moiety on antioxidant, and anti-inflammatory activity, cytotoxicity, and the ability of flavonoids to modulate drug-resistance mechanisms in bacteria. The anti-inflammatory activity disappeared after the introduction of aniline into the flavonoids and the cytotoxicity remained low. Although the ability of quercetin and luteolin to modulate bacterial resistance to antibiotics has already been published, this is the first report on the molecular mechanism of this process. Both flavonoids attenuate erythromycin resistance by suppressing the ribosomal methyltransferase encoded by the ermA gene in Staphylococcus aureus. Notably, 4-(trifluoromethyl)anilino quercetin emerged as a potent ErmA inhibitor, likely by interacting with the RNA-binding pocket of ErmA. Additionally, both 4-fluoroanilino derivatives effectively impended the staphylococcal efflux system. All the prepared derivatives exhibited superior activity in modulating gentamicin resistance in S. aureus compared to the parent compounds. Overall, the incorporation of substituted anilines into the flavonoid core significantly enhanced its ability to combat multidrug resistance in bacteria.
This publication is licensed under CC-BY 4.0 .
Copyright © 2024 The Authors. Published by American Chemical Society
Subjects
Introduction
The introduction of new C–N bonds into aromatic compounds holds significant promise in medicinal chemistry and natural product synthesis. (1) Aromatic amines are integral components found in various biologically active compounds, such as benzodiazepines and cyclin-dependent kinase inhibitors. (2) However, methods for introducing amino groups into aromatic compounds remain limited. The Ullmann reaction was described in 1903 as a copper-catalyzed coupling of aromatic halides with amines, (3) followed by a similar Goldberg reaction used for the arylation of amides. (4) These reactions have limitations, including high reaction temperatures, a narrow scope, and the need for equimolar amounts of copper. Over the years, reaction conditions for Ullmann-type reactions have been optimized to proceed at lower temperatures, and Cu0 has been replaced by Cu(I), often in combination with various bidentate N, N- or N, O- ligands such as oxalic acid diamides or amino acids. (5,6)
In 1994, Buchwald (7) and Hartwig (8) simultaneously published studies on the Pd-catalyzed cross-coupling reaction of aromatic halides with amines. This reaction has since gained widespread recognition for its versatility, low catalyst loading, and cost-effectiveness, making it a cornerstone method for C–N bond formation in both academia and the pharmaceutical industry over the past three decades. (9)
Flavonoids have garnered significant attention as naturally occurring compounds due to their diverse biological activities and generally low toxicity. (10) Previously reported synthetic and naturally occurring nitrogen-containing flavonoids exhibited interesting biological activities. For example, azaquercetin and azaluteolin have been reported to act as influenza endonuclease inhibitors. (11) Rohitukine, a naturally occurring flavonoid substituted at C-8 with N-methyl-3-hydroxy-piperidine, showed anticancer, anti-inflammatory, and immunomodulatory activities. (12) Rohitukine and its synthetic derivatives flavopiridol and riviciclib are currently in various stages of clinical trials as potential anticancer drugs that act as CDK inhibitors and apoptosis inducers. (13)
Furthermore, as recently summarized by Nguyen and Bhattacharya, (14) quercetin and its derivatives can modulate antibiotic resistance and act synergistically with antibiotics. Since the search for new antimicrobial agents seems to be insufficient in recent decades, the possibility of inhibiting resistance mechanisms and restoring the efficacy of old antibiotics presents a promising approach in the fight against resistant pathogens. (15) Quercetin restored the efficacy of fluconazole in fluconazole-resistant Candida tropicalis, (16) meropenem in carbapenem-resistant Escherichia coli and Klebsiella pneumoniae, (17) amoxicillin in amoxicillin-resistant Staphylococcus epidermidis, (18) levofloxacin, ceftriaxone, gentamicin, tobramycin and amikacin in multidrug-resistant Pseudomonas aeruginosa, (19) florfenicol in Aeromonas hydrophila, (20) colistin and of amikacin in colistin-resistant Acinetobacter baumannii. (21) Quercetin conjugate with pivaloxymethyl restored the activity of ampicillin, cefepime, and vancomycin in multidrug-resistant strains of Staphylococcus aureus and Enterococcus faceium. (22) Moreover, both quercetin and luteolin inhibited β-lactamase and acted synergistically with ceftazidime in β-lactamase-producing Streptococcus pyogenes, (23) the three-component mixture of flavonoids (quercetin, morin, rutin) acted synergistically with amoxicillin, ampicillin, cephradine, ceftriaxone, imipenem, and methicillin in methicillin-resistant S. aureus (24) and quercetin alone had an additive effect with ampicillin, cephradine, ceftriaxone, imipenem, and methicillin in methicillin-resistant S. aureus. (24) Quercetin also inhibited case in hydrolase P─the virulence factor in S. aureus (25) and targeted quorum sensing of P. aeruginosa. (19)
The compounds in this study were designed based on our previous findings, which focused on the preparation of halogenated derivatives of flavonoids and the effects of this substitution on biological activity. We have reported that halogenation enhances the synergistic effect of flavonoids with antibiotics, (26) but only fluorinated flavonoids were absent in this work due to the complicated preparation. Halogenated derivatives were then used as reactive intermediates for Suzuki cross-coupling reactions–allowing the fluorine to be introduced into the flavonoid core via reaction with fluoroboronic acids. (27) Unfortunately, according to our unpublished results, the products of Suzuki cross-coupling reactions did not show improved biological effects. Therefore, we hypothesized that the introduction of the amino group may lead to such an improvement. Halogenated derivatives can be used as starting material for Buchwald–Hartwig amination or Ullmann-type reactions, which allow the preparation of synthetic, nitrogen-containing, fluorine-substituted flavonoids.
Buchwald–Hartwig amination has so far only been described for 6-bromoflavone, which lacks the −OH groups. Fitzmaurice et al. reported a cross-coupling of 6-bromoflavone and n-hexylamine affording 6-hexylamine flavone. (28) 6-Bromoflavone also reacted with amino acids to form flavone-amino acid hybrids. (29)
The aim of this study was to prepare a library of novel aniline-substituted flavonoids with various substituents, including fluorine, which have the potential to improve the biological activity of flavonoids. The derivatives prepared were subjected to extensive testing, including antioxidant and anti-inflammatory activity, cytotoxicity to human fibroblasts and keratinocytes, and the ability to modulate multidrug resistance in bacteria.
Results and Discussion
Chemistry
Optimization of Buchwald–Hartwig Amination
A series of alkyl and aryl amines was tested for the coupling, namely: n-hexylamine, 4-fluoroaniline, 4-methoxyaniline (p-anisidine), aniline, 4-(trifluoromethyl)aniline, 3,5-dimethoxyaniline, 4-fluoroaniline, 4-(trifluoromethoxy)aniline, morpholine, and piperidine. The reaction of 8-iodo-3,3′,4′,5,7-penta-O-isopropoxy quercetin with n-hexylamine under the previously published conditions (Pd2(dba)3, BINAP, NaOtBu, toluene) (28) failed. 8-Bromo-3,3′,4′,5,7-penta-O-isopropoxy quercetin prepared using our previously published method (26) was used under the same reaction conditions with n-hexylamine, but this reaction failed as well. The reaction was later optimized with more reactive arylamines such as p-anisidine and 4-fluoroaniline (Table 1). Initially, the reaction was conducted with p-anisidine using BINAP and various bases in toluene at 100 °C (Entries 1–6, Table 1). Under these reaction conditions, only traces of the product were detected in the HPLC/MS analysis. To improve the reaction efficiency, BINAP was replaced by more sterically hindered ligands such as tBuXPhos or SPhos. Additionally, the use of NaOtBu as the base led to an improved HPLC conversion of 30%. Interestingly, optimization efforts revealed that lower reaction temperatures favored higher conversion rates. Further experimentation without microwave irradiation (Entry 15, Table 1) yielded similar outcomes, albeit requiring a longer reaction time of 16 h.
Table 1. Conditions Used for the Optimization of the Reaction Conditionsa
| entry | amine | ligand | base | solvent | T [°C] | time [h] | yield [%] |
|---|---|---|---|---|---|---|---|
| 1 | p-anisidine | BINAP | Cs2CO3 | toluene | 110 | 16 | 0 |
| 2 | p-anisidine | BINAP | NaOtBu | toluene | 110 | 2 | 0 |
| 3 | p-anisidine | BINAP | K3PO4 | toluene | 110 | 16 | 0 |
| 4 | n-hexylamine | BINAP | K3PO4 | toluene | 110 | 16 | 0 |
| 5 | p-anisidine | BINAP | HMDS | toluene | 100 | 16 | decomposition |
| 6 | p-anisidine | BINAPb | K2CO3 | toluene | 80 | 16 | 0 |
| 7 | p-anisidine | tBuXPhos | K2CO3 | toluene | 100 | 16 | 0 |
| 8 | p-anisidine | tBuXPhos | NaOtBu | toluene | 140 | 16 | 20 |
| 9 | p-anisidine | tBuXPhos | LiHMDS | toluene | 140 | 16 | decomposition |
| 10 | p-anisidine | tBuXPhos | NaOtBu | toluene | 120 | 48 | 30%c |
| 11 | 4-fluoroaniline | tBuXPhos | NaOtBu | toluene | 120 | 48 | 40%c |
| 12 | 4-fluoroaniline | SPhos | NaOtBu | toluene | 120 | 16 | 40%c |
| 13 | 4-fluoroaniline | tBuXPhos | NaOtBu | 1,4-dioxane | 85 | 2d | 40 |
| 14 | 4-fluoroaniline | tBuXPhos | NaOtBu | toluene | 80 | 2d | 40 |
| 15 | 4-fluoroaniline | tBuXPhos | NaOtBu | THF | 70 | 16 | 50 |
| 16 | 4-fluoroaniline | tBuXPhos | NaOtBu | THF | 70 | 2d | 54 |
aPd2(dba)3 was used as a catalyst unless otherwise stated.
bPd(OAc)2 was used as a catalyst.
cConversion was determined by HPLC analysis.
dThe reaction was carried out in a microwave reactor.
After successful optimization of the reaction conditions (Entry 16, Table 1), a library of flavone, quercetin, and luteolin derivatives substituted at C-8 with various anilines was prepared using the Buchwald-Hartwig amination. The prepared derivatives and the isolated yields are summarized in Figure 1.

The reaction with 4-(trifluoromethoxy)aniline proved unsuccessful, likely attributed to the strong electron-withdrawing effect of the −OCF3 group, which might have hindered the desired reactivity. Similarly, attempts to react with alkylamines such as n-hexylamine, morpholine, and piperidine under optimized reaction conditions also failed. This could be attributed to the relatively low nucleophilicity of alkylamines compounded by steric hindrance at C-8 of the flavonoid. In general, the presence of an alkyl group (e.g., prenyl, allyl) in the flavonoid backbone typically enhances biological activity and lipophilicity. (30) The reaction with n-hexylamine was successful only with flavone which lacks OH groups on the A-ring, affording compound 2.
Optimization of Ullmann Reaction
Given the unsuccessful outcomes of the Buchwald-Hartwig reaction, an alternative approach using the Ullmann-type reaction for the introduction of alkylamines was investigated. Previously reported reaction conditions (1 equiv amine, 2.5 equiv K2CO3, 10% CuI, DMF, 0.1 mL water) (5) were used for the reaction of 8-bromo flavonoids with n-hexylamine, and this reaction was as unsuccessful as a reaction with glycine methyl ester. Other attempts employed a CuI/amino acid-promoted reaction of aryl halogens with amines catalyzed with CuI and amino acids such as l-proline or N,N-dimethylglycine. (6) The coupling of 8-bromo-3,3′,4′,5,7-penta-O-isopropoxy quercetin with n-hexylamine, or morpholine carried out in the presence of CuI, proline, and K2CO3, did not yield the desired products. All unsuccessful attempts to optimize the Ullmann reaction are summarized in Table S1. Unfortunately, attempts to produce flavonoids substituted at C-8 with alkylamines failed, probably due to activation of the A-ring of the flavonoids and steric hindrance at the C-8 position.
Biological Activity
All quercetin and luteolin derivatives prepared were screened for biological activity. Cytotoxicity, antioxidant, antibacterial, and anti-inflammatory activities as well as the ability of the prepared derivatives to affect the multidrug resistance of bacteria were investigated and compared with the parent flavonoids.
Antioxidant and Anti-Inflammatory Activity
To evaluate the antioxidant activity of the prepared derivatives and the respective parent compounds, cellular antioxidant activity (CAA) was measured in macrophages. Compared to other in vitro antioxidant assays, this method provides partial information about the uptake and metabolism of the compounds, because, in this assay, they must first enter the cell to exert antioxidant activity. (31) The parent compounds quercetin and luteolin showed antioxidant activity with IC50 values of 5.85 μM and 4.48 μM, respectively (Table S2). Derivatization of quercetin at C-8 with 4-fluoroaniline (5) increased the antioxidant activity of quercetin by 1.7-fold. Among luteolin derivatives, the 8-(4-fluoroanilino) luteolin (11) and 8-anilino luteolin (13) showed better antioxidant activity than the parent compound. The concentration of these derivatives required to halve the cellular radicals decreased 1.5-fold compared to luteolin. On the other hand, derivatization with 4-(trifluoromethyl)aniline (8, 14) and the 3-fluoroaniline moiety (15) significantly decreased the antioxidant activity.
The anti-inflammatory activity of flavonoids was evaluated as their ability to decrease the production of signaling molecules that mediate inflammation, such as nitric oxide (NO), tumor necrosis factor (TNF-α), and interleukin 6 (IL-6), in LPS-stimulated macrophages. Parent compounds showed significant activity in these assays, as reported previously, (32,33) but the activity of amino derivatives decreased in all assays (Table S3), except for 8-(4-fluoroanilino) luteolin (11), 8-anilino luteolin (13), and 8-(3-fluoroanilino) luteolin (15) which exhibited the same ability to inhibit IL-6 production as luteolin.
Cytotoxicity of Flavonoids on Healthy Cells
The cytotoxicity of the prepared derivatives was evaluated by their ability to decrease the viability of immortalized human keratinocytes (HaCaT) and human dermal fibroblasts (HDF). The concentrations of flavonoids that halved the viability of the respective cells are summarized in Table S4. The synthetic modification of the flavonoid scaffold only increased the very low toxicity of quercetin in HaCaT. The IC50 values were above 25 μM in all cases, compared to less than 1 μM for doxorubicin.
Modulation of Antibiotic-Resistant Phenotype in Bacteria
To evaluate the ability to modulate bacterial resistance, the tested flavonoids themselves cannot exert antimicrobial activity; therefore, the nontoxic concentration was used, as indicated in Table S5. Clinically relevant antibiotics were selected at breakpoint concentrations for susceptibility testing according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST, version 11.0). Erythromycin and gentamicin at breakpoint concentrations (1 mg/L) did not affect the multidrug-resistant clinical strain of S. aureus (MRSA). Flavonoids and their derivatives (from 1 μM to the highest nontoxic concentration) were used in combination with the breakpoint concentration of the antibiotics. After coincubation, the minimum inhibitory concentration (MIC) of flavonoids inhibiting the visible growth of bacteria was determined (Table 2).
Table 2. Minimum Inhibitory Concentration of Quercetin, Luteolin, and their Derivatives Inhibiting the Visible Growth of Staphylococcus aureus MRSA 9 in the Presence of Breakpoint Concentration of Antibiotic (1 mg/L)abc
| gentamicin | erythromycin | |||
|---|---|---|---|---|
| quercetin (4) | >200 note 1 | 117.3 ± 4.7 | ||
| 8-(4-fluoroanilino) quercetin (5) | 45.2 ± 0.6 | *** | >200 | |
| 8-(4-methoxyanilino) quercetin (6) | >200 note 2 | >200 | ||
| 8-(anilino) quercetin (7) | 43.8 ± 1.6 | *** | >200 | |
| 8-(4-(trifluoromethyl)anilino) quercetin (8) | 8.1 ± 0.6 | *** | >25 note 3 | |
| 8-(3,5-dimethoxyanilino) quercetin (9) | >200 | >200 | ||
| luteolin (10) | 84.7 ± 1.8 | 147.3 ± 7.7 | ||
| 8-(4-fluoroanilino) luteolin (11) | 7.9 ± 0.5 | *** | >25 note 4 | |
| 8-(4-methoxyanilino) luteolin (12) | 44.0 ± 1.6 | *** | 76.3 ± 1.9 | *** |
| 8-(anilino) luteolin (13) | 24.7 ± 0.8 | *** | >200 | |
| 8-(4-(trifluoromethyl)anilino) luteolin (14) | 7.6 ± 0.1 | *** | >15 note 5 | |
| 8-(3-fluoroanilino) luteolin (15) | 12.4 ± 0.3 | >200 | ||
aData are presented as the minimum inhibitory concentration (MIC, μM); average of three repetitions ± standard error of the mean.
bStars indicate the statistically improved activity when compared to the parent compound (Students t-test, *p < 0.05, ** p < 0.005, ***p < 0.0005).
cThe notes indicate that the maximum concentration used inhibited bacterial growth to: 157.0 ± 1.2, 250.7 ± 0.3, 357.0 ± 0.6%, 436.3 ± 1.8%, and 537.7 ± 1.3%.
The prepared derivatives showed the ability to revert the gentamicin-resistant phenotype into a sensitive one in MRSA. 8-(4-Trifluoromethyl anilino) quercetin (8) reverted the resistant phenotype to a sensitive one at 8.1 μM, as did 8-(4-fluoroanilino) luteolin (11) with a MIC of 7.9 μM. In addition, both derivatives of quercetin and luteolin substituted at C-8 by aniline reversed the resistant phenotype with MIC values of 43.83 μM, and 24.66 μM, respectively. The derivative 8-(4-trifluoromethyl anilino) luteolin (14) reversed the resistant phenotype at 7.63 μM. On the other hand, 8-(4-methoxyanilino) luteolin (12) was the only derivative that was able to revert erythromycin-resistant MRSA into a sensitive one with a MIC of 76.3 μM. This luteolin derivative was more than twice as active as the parent compound.
To our knowledge, i) this is the first study demonstrating the synergistic effect of quercetin or luteolin with erythromycin, ii) a number of the derivatives prepared were more potent than the parent compounds, and iii) the therapeutic indexes have increased significantly considering that the compounds are used at nontoxic concentrations. Future research should aim to contextualize our results within the existing knowledge to better understand the novelty and implications of our findings.
Modulation of Bacterial Efflux System
The application of antibiotics often leads to oxidative stress in bacteria, which triggers the efflux pump systems that contribute to antimicrobial resistance. (34) Therefore, modulation of the efflux system has been proposed as another plausible target of derivatives. The efflux pump inhibitor carbonyl cyanide 3-chlorophenylhydrazone (CCCP) was used as a comparator in our assay. Its action destroys the proton-motive force at the membrane so that the efflux pump cannot transport substrates out of the cell. One such universal substrate is ethidium bromide, the accumulation of which in the cell can be measured using fluorescence. As can be seen in Figure 2, the administration of 25–100 μM CCCP increases the accumulation of ethidium bromide in the cell. Compared to CCCP, both luteolin and quercetin are also efflux inhibitors, but only luteolin was significantly better than CCCP at the same concentration (100 μM). In contrast, the quercetin derivatives were significantly better inhibitors than the comparator CCCP at the lower concentrations tested (25 and 50 μM). At a concentration of 25 μM, 8-(4-fluoroanilino) quercetin (5) showed a 75% accumulation of ethidium bromide compared to 100 μM CCCP. Luteolin derivatives and, in particular, 8-(4-fluoroanilino) luteolin (11) also showed higher activity than CCCP alone. At a concentration of 25 μM, the activity was comparable to 8-(4-fluoroanilino) quercetin (5).

Mechanism of Erythromycin-Resistance Modulation in S. aureus
Erythromycin is a macrolide antibiotic that inhibits proteosynthesis by binding to the 50S subunit of the ribosome. In Staphylococcus species, resistance to erythromycin is associated with the presence of methyltransferases (encoded by erm genes) that alter the ribosomal target site. Another typical mechanism of resistance to erythromycin is the presence of an ATP-dependent efflux pump encoded by the msr(A) gene or a major facilitator superfamily (MFS) pump encoded by the lmrS gene. Both efflux pumps reduce the concentration of erythromycin in the cell below the therapeutic dose by transporting it across the membrane to the extracellular space. Another erythromycin resistance gene is the mph(C) gene, the product of which is a phosphotransferase that alters the structure of macrolide antibiotics. To elucidate the mechanism of erythromycin resistance modulation in S. aureus, further tests were performed with the strains MRSA 331 and MRSA 3596, which inactivate erythromycin via a single mechanism (ermC and ermA, respectively). At the same time, all strains possess the transmembrane efflux pump LmrS. Therefore, if the activity was not strain-specific, it would be necessary to consider the effect of the derivatives on this pump (Table 3).
Table 3. Characterization of the Mechanism of Resistance to Erythromycin in Clinical Isolates of S. aureus
| a gene of erythromycin resistance | MRSA 9 | MRSA 331 | MRSA 3596 |
|---|---|---|---|
| ermA | positive | negative | positive |
| ermB | positive | negative | negative |
| ermC | positive | positive | negative |
| msrA | negative | negative | negative |
| mphC | negative | negative | negative |
| lmrS | positive | positive | positive |
The mechanism was determined based on the presence/absence of the gene responsible for antibiotic modification in both plasmid and genomic DNA using PCR.
Both quercetin and luteolin showed synergistic activity with erythromycin against the S. aureus strain MRSA 3596 (Table 4), which uses the ermA gene product to eliminate the antibiotic. The quercetin derivative 8-(4-(trifluoromethyl)anilino) quercetin (8) was even 7 times more effective than its parent compound. Due to its lower toxicity, its therapeutic index is equal to 13.94 and 13.32 for the tested HaCaT and HDF cell lines, respectively, which makes it a drug with a suitable therapeutic profile. On the contrary, none of the luteolin derivatives was more effective than the parent compound, only the 8-(4-methoxyanilino) luteolin (12) derivative retained the original properties of luteolin.
Table 4. Mode of Antimicrobial Action of Quercetin (4), Luteolin (10), and their Derivatives with Erythromycin Against Methicilin-Resistant S. aureus 331 Strain Positive for the Presence of the ermC Gene and 3596 Strain Positive for ermA Gene Encoding Ribosomal Methyltransferasesa
| MRSA 331 | MRSA 3596 | |||||||
|---|---|---|---|---|---|---|---|---|
| MIC [μM] | MIC [μM] | |||||||
| erythromycin [1 mg/L] | yes | no | FIC | effect | yes | no | FIC | effect |
| quercetin (4) | 190.9 ± 0.5 | 193.1 ± 1.0 | 0.99 ± 0.01 | additive | 58.6 ± 1.2 | 178.1 ± 2.7 | 0.33 ± 0.01 | synergy |
| 8-(4-(trifluoromethyl)anilino) quercetin (8) | 15.9 ± 0.8 | 6.9 ± 0.2 | 2.30 ± 0.03 | antagonism | 8.4 ± 1.1 | 37.9 ± 0.1 | 0.22 ± 0.03 | synergy |
| luteolin (10) | 31.6 ± 2.5 | 28.1 ± 0.3 | 1.12 ± 0.10 | indifference | 14.3 ± 0.9 | 51.1 ± 1.3 | 0.28 ± 0.02 | synergy |
| 8-(4-fluoroanilino) luteolin (11) | 57.4 ± 0.2 | 57.6 ± 0.2 | 1.00 ± 0.01 | indifference | 28.0 ± 0.5 | 32.9 ± 0.6 | 0.85 ± 0.03 | additive |
| 8-(4-methoxyanilino) luteolin (12) | 54.8 ± 0.4 | 54.4 ± 2.1 | 1.01 ± 0.05 | indifference | 20.0 ± 0.6 | 53.6 ± 0.5 | 0.37 ± 0.01 | synergy |
| 8-(4-(trifluoromethyl)anilino) luteolin (14) | 27.0 ± 1.5 | 27.0 ± 5.1 | 1.00 ± 0.25 | indifference | 29.9 ± 1.4 | 14.4 ± 0.1 | 2.07 ± 0.11 | antagonism |
a
Fractional Inhibitory Concentration Index (FIC) < 0.5 indicates synergism, > 0.5–1 indicates additive effects, > 1 to <2 indicates indifference, and ≥2 indicates antagonism.
Molecular Docking Analyses
Molecular docking experiments revealed that quercetin, luteolin, and their derivatives share a binding pocket with S-adenosyl-l-methionine (SAM), indicating possible competition for the binding site. On the other hand, blind experiments showed a clear change in the docking trend. All tested molecules showed positive docking in the RNA (central) pocket, with a larger volume available. These results have revealed intriguing insights into the role of these molecules.
The low alphafold score confidence for the N-terminal region does not allow a complete interpretation of the binding prediction due to the flexibility of this region. However, the influence of the 8TQNF11 motif could play an interesting role in the N-terminal motions preventing the accommodation of tested molecules within the SAM pocket.
Dynamics and mutations are variables that could strongly prevent the expected docking of the derivatives either in the upper pocket, a phenomenon observed in the ErmB parent possessing the mutation 8SQNF11, or in the RNA pocket. The mentioned mutation is of particular interest for future studies on the importance of this residue for enzyme activity. In addition, the docking positions of all molecules in the central part of the protein, shown in the blind docking, offer reasonable potential for influencing enzymatic activity. This region appears to be involved in the electrostatic interaction with the target RNA, as studied by Goh et al. (35)
As mentioned above, blind docking can exhibit highly variable behavior in binding modes. By constraining the algorithm’s search in the binding pocket, we were able to better interpret the binding modes in the putative binding pocket. The lack of experimental data on the studied system prompted us to validate our docking experiments on a closely related system: ermC (pdbid: 1QAN) studied by Schluckebier et al. (36)
S-Adenosylmethionine (SAM) crystal structure (dark blue) within ermC crystal structure (gray) and docked SAM (light blue) within predicted ermA (violet) were superimposed in Figure 3. The observed differences in SAM orientation can be attributed to the presence of water molecules in the crystal, notably HOH-949 (Figure S1). The docking energies for SAM and selected flavonoids are summarized in Table S7.

The catechol groups of quercetin (4, green) and luteolin (10, purple) point toward the shallow groove and form hydrogen bonds (yellow dashed) with the backbone residues Phe-44 and Lys-41 as well as Nd1-His-43. Hydrophobic interactions, which are crucial for the binding affinity for the selected pocket, are mediated by ring A and ring C with additional H-bonds interacting with Asn-11 and the additional 3-hydroxyl group on the C-ring of quercetin interacting with Glu-59 (Figure S2).
Docking of 8-(4-(trifluoromethyl)anilino)luteolin (14, light-blue), 8-(4-(trifluoromethyl)anilino)quercetin (8, green) and 8-(4-fluoroanilino)luteolin (11, yellow) suggested that trifluoromethyl and fluoro substituents are buried in the shallow groove stabilizing the system by replacing H-bonds. Rings A and C occupy positions in the hydrophobic pocket at the end of the beta-sheet, forming H-bonds with Asp-84 and Ile-85, consistent with the adenosine interaction highlighted in the ErmC crystal structure (Figure 3). The catechol group forms an H-acceptor bond with N-Asn-105 at the loop connecting the α helix and beta-sheet, as well as an H-donor bond with Pro-6 and an H-donor toward Thr-9 backbone on N-terminal (Figure 4).

The docking results have shown the importance of the H-acceptor donor groups within the shallow groove. This was confirmed by the ability of quercetin and luteolin to mimic the stability of SAM-cysteine in the pocket by forming a network of H-bonds. In addition, hydrophobic interactions are mediated by the A and C rings of flavonoids coordinated by residues Asp-84 and Ile-85 providing SAM adenosine activity.
Mechanism of Gentamicin-Resistance Modulation in S. aureus
Among the mechanisms of resistance to gentamicin previously described in S. aureus, the presence of enzymes that alter the structure of aminoglycosides is crucial. These enzymes can transfer nucleotides, phosphates, or acetyls to various −OH or −NH2 groups of gentamicin, preventing its subsequent interaction with the cellular target, i.e., the 30S ribosomal subunit. The bifunctional aminoglycoside-modifying enzyme with acetylation and phosphotransferase activities encoded by the gene aac(6’)/aph(2’), 4′,4″ adenyltransferase encoded by the aadD gene, and aminoglycoside O-phosphotransferase encoded by the gene aph(3′) are the most important. (37) As can be seen in Table 5, the clinical isolate MRSA 9 possesses all three genes that may be responsible for the inactivation of gentamicin. For this reason, further testing continued using strains MRSA 3596 and MRSA 1584, which inactivate gentamicin only by a single mechanism (aadD and aac(6’)-aph(2’’), respectively).
Table 5. Characterization of the Mechanism of Resistance to Gentamicin in Clinical Isolates of S. aureus
| antibiotic | gene of resistance | MRSA 9 | MRSA 3596 | MRSA 1584 |
|---|---|---|---|---|
| gentamicin | aac(6′)-aph(2″) | positive | negative | positive |
| aadD | positive | positive | negative | |
| aph(3′) | positive | negative | negative |
The mechanism was determined based on the presence/absence of the gene responsible for antibiotic modification in both plasmid and genomic DNA using qPCR.
All derivatives prepared exhibited synergistic activity against MRSA strain 3596, which uses adenyltransferases (encoded by the aadD gene) to eliminate antibiotics (Table S6). Surprisingly, according to the literature, gentamicin is not a substrate of the adenyltransferase, (38) which was confirmed by evaluating the effect of gentamicin on the adenyltransferase. Therefore, the flavonoids affect the gentamicin resistance of S. aureus via an unknown mechanism that is still under investigation.
Conclusion
In summary, we have prepared a library of novel derivatives of quercetin and luteolin modified at C-8 with various substituted anilines. The anti-inflammatory activity vanished after the introduction of the aniline group, while the cytotoxicity of the prepared derivatives remained low. Among the prepared derivatives, 8-(4-(trifluoromethyl)anilino) quercetin (8) and 8-(4-methoxyanilino) luteolin (14) showed the ability to modulate erythromycin resistance of Staphylococcus aureus by inhibiting ribosomal methyltransferase. Furthermore, the prepared derivatives acted as inhibitors of transmembrane efflux pumps at lower concentrations (25 and 50 μM) than the positive control CCCP and the parent compounds. All derivatives effectively modulated gentamicin resistance in gentamicin-resistant Staphylococcus aureus, although the underlying mechanism remains to be elucidated. Our findings underscore the potential of introducing amino groups into flavonoid structures to enhance their ability to combat drug resistance. According to our findings, the introduction of the anilino-substituents led to a certain focusing of the ability to modulate the MDR, which confirms the correctness of our approach. These derivatives hold promise for modulating drug resistance in adjuvant therapy. However, further investigation is needed to fully understand the specificity of these inhibitors against similar enzymes in other bacterial genera. Overall, our study contributes insights into the development of flavonoid-based therapeutics for combating antibiotic resistance, opening avenues for future research in this important field.
Experimental Section
General Information
Procedures involving oxygen- or moisture-sensitive materials were performed with anhydrous solvents (vide infra) under an argon atmosphere in flame-dried flasks using the Schlenk standard technique. Analytical TLC was performed on Al plates (Silica Gel 60 F254; Merck, Darmstadt, Germany). Purification was performed using the preparative HPLC system (Shimadzu, Kyoto, Japan). Preparative HPLC separations were performed using an ASAHIPAK GS-310 column (Shodex, Munich, Germany) at 5 mL/min MeOH (isocratic). NMR analyses were performed using spectrometers Bruker Avance III HD 500 MHz equipped with a cryoprobe (1H 500, 13C{1H} 126, and 19F 470 MHz), and Bruker Avance III 400 MHz (1H 400, 13C{1H} 100, and 19F 376 MHz) instrument (Bruker, Karlsruhe, Germany) in DMSO-d6, at 25 °C. The signal in DMSO-d6 was used as a reference (δH 2.50, δC 39.52). High-resolution mass spectra (HRMS) were measured using an LTQ Orbitrap XL hybrid mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA) equipped with an electrospray ion source and operated at the resolution of 100,000. Samples were loop-injected into methanol/water (4:1) at a flow rate of 100 μL/min. 8-Bromo-3,3′,4′,5,7-penta-O-isopropoxy quercetin and 8-bromo-3′,4′,5,7-tetra-O-isopropoxy luteolin were prepared according to a previously published method for selective bromination. (26) Commercially available reagents and ligands were purchased from Sigma-Aldrich (Darmstadt, Germany), Alfa Aesar (Ward Hill, MA, USA), Acros Organics (Morris Plains, NJ, USA), and TCI Chemicals (Gurugram, India) and were used without further purification unless otherwise stated.
General Procedure for Buchwald-Hartwig Amination
The respective brominated flavonoid (1 equiv) was dissolved in dry degassed THF (2 mL) and added to Pd2(dba)3 (3 mol %), tBuXPhos (6 mol %), and NaOtBu (1.5 equiv) in a microwave vessel equipped with a stir bar under inert gas. The corresponding amine (1.2 equiv) was added. The reaction mixture was irradiated in a microwave reactor at 70 °C for 2 h. The reaction mixture was then allowed to cool to room temperature. The reaction mixture was filtered through a microfilter (PTFE, 0.45 μm), and washed with water (3 × 20 mL) and brine (3 × 20 mL). The combined organic fractions were dried over Na2SO4, evaporated in vacuo, and the residue was dissolved in dry dichloromethane (2 mL). The reaction mixture was cooled to 0 °C and BCl3 (1 M, 10 equiv) was added dropwise. The reaction mixture was then heated to 40 °C and stirred for 2 h, then cooled to 0 °C, and an excess of methanol was added. The reaction mixture was evaporated in vacuo, and the residue was purified by preparative HPLC chromatography (ASAHIPAK, 5 mL/min, MeOH isocratic) yielding the corresponding product.
6-(Hexylamino)-2-phenyl-4H–1-benzopyran-4-one (6-(Hexylamino) flavone, 2)
A yellow solid (62 mg, 60%). 1H NMR (500 MHz, DMSO-d6) δ 8.08–8.03 (m, 2H, H-2′, 6′), 7.60–7.53 (m, 4H, H-8, H-3′, 4′, 5′), 7.13 (dd, J = 9.1, 2.9 Hz, 1H, H-7), 6.94 (d, J = 2.9 Hz, 1H, H-5), 6.91 (s, 1H, H-3), 6.07 (t, J = 5.4 Hz, 1H, NH), 3.09–2.98 (m, 2H, CH2–1″), 1.58 (p, J = 7.2 Hz, 2H, CH2–2″), 1.44–1.34 (m, 2H, CH2–3″), 1.36–1.25 (m, 4H, CH2–4″,5″), 0.91–0.85 (m, 3H, CH3-6″) ppm. 13C{1H} NMR (126 MHz, DMSO-d6) δ 177.2 (C-4), 161.6 (C-2), 147.9 (C-9), 146.9 (C-6), 131.6 (C-1′), 131.4 (C-4′), 129.1 (2C, C-3′, 5′), 126.1 (2C, C-2′, 6′), 124.3 (C-10), 121.1 (C-7), 119.1 (C-8), 105.8 (C-3), 101.1 (C-5), 43.1 (CH2–1″), 31.1 (CH2–4″), 28.4 (CH2–2″), 26.4 (CH2–3″), 22.2 (CH2–5″), 14.0 (CH3-6″) ppm. HRMS (ESI, m/z) calcd for C21H22O2N [M – H]−320.16560, found 320.16534.
6-(4-Methoxyanilino)-2-phenyl-4H–1-benzopyran-4-one (6-(4-Methoxyanilino) flavone, 3)
A yellow solid (88.4 mg, 78%). 1H NMR (500 MHz, DMSO-d6) δ 8.23 (s, 1H, NH), 8.09–8.05 (m, 2H, H-2′, 6′), 7.65 (d, J = 9.0 Hz, 1H, H-8), 7.62–7.55 (m, 3H, H-3′, 4′, 5′), 7.42 (d, J = 2.9 Hz, 1H, H-5), 7.36 (dd, J = 9.0, 2.9 Hz, 1H, H-7), 7.14–7.10 (m, 2H, H-2″, 6″), 6.96–6.92 (m, 3H, H-3″, 5″ and H-3), 3.75 (s, 3H, OCH3) ppm. 13C{1H} NMR (126 MHz, DMSO-d6) δ 177.0 (C-4), 161.9 (C-2), 154.7 (C-4″), 149.1 (C-9), 143.5 (C-6), 135.2 (C-1″), 131.6 (C-4′), 131.5 (C-1′), 129.1 (2C, C-3′, 5′), 126.2 (2C, C-2′, 6′), 124.2 (C-10), 122.7 (C-7), 121.7 (2C, C-2″, 6″), 119.6 (C-8), 114.8 (2C, C-3″, 5″), 106.0 (C-3), 104.8 (C-5), 55.3 (OCH3) ppm. HRMS (ESI, m/z) calcd for C22H16O3N [M – H]− 342.11357, found 342.11322.
2-(3,4-Dihydroxyphenyl)-8-(4-fluoroanilino)-3,5,7-trihydroxy-4H–1-benzopyran-4-one (8-(4-Fluoroanilino) quercetin, 5)
A green solid (57.4 mg, 54%). 1H NMR (500 MHz, DMSO-d6) δ 12.40 (s, 1H, HO-5), 10.60 (s, 1H, HO-7), 9.58 (s, 1H, HO-4′), 9.42 (s, 1H, HO-3), 9.07 (s, 1H, HO-3′), 7.63 (d, 1H, J = 2.3 Hz, H-2′), 7.10 (s, 1H, -NH), 6.96 (dd, 1H, J = 8.5, 2.2 Hz, H-6′), 6.94–6.88 (m, 2H, H-3″,5″), 6.64 (d, 1H, J = 8.5 Hz, H-5′), 6.58–6.52 (m, 2H, H-2″,6″), 6.35 (s, 1H, H-6) ppm. 13C{1H} NMR (126 MHz, DMSO-d6) δ 176.1 (C-4), 160.5 (C-7), 157.3 (C-5), 155.0 (d, J = 231.9 Hz, C-4″), 151.5 (C-9), 147.6 (C-4′), 146.7 (C-2), 144.8 (C-3′), 144.1 (dm, J = 1.8 Hz, C-1″), 135.7 (C-3), 122.0 (C-1′), 119.3 (C-6′), 115.8 (C-2′), 115.2 (C-5′), 115.1 (d, 2C, J = 22.1 Hz, C-3″,5″), 114.2 (d, 2C, J = 7.5 Hz, C-2″,6″), 108.3 (C-8), 103.3 (C-10), 98.1 (C-6) ppm. 19F NMR (470 MHz, DMSO-d6) δ −128.28 ppm. HRMS (ESI, m/z) calcd for C21H13O7F [M – H]− 410.06815, found 410.06781.
2-(3,4-Dihydroxyphenyl)-8-(4-methoxyanilino)-3,5,7-trihydroxy-4H–1-benzopyran-4-one (8-(4-Methoxyanilino) quercetin, 6)
A brown solid (11.8 mg, 16%). 1H NMR (500 MHz, DMSO-d6) δ 12.40 (s, 1H, HO-5), 10.50 (s, 1H, HO-7), 9.56 (s, 1H, HO-4′), 9.39 (bs, 1H, HO-3), 9.07 (s, 1H, HO-3′), 7.65 (d, 1H, J = 2.2 Hz, H-2′), 6.90 (dd, 1H, J = 8.5, 2.3 Hz, H-6′), 6.77 (bs, 1H, NH), 6.75–6.69 (m, 2H, H-3″, 5′′), 6.61 (d, 1H, J = 8.5 Hz, H-5′), 6.56–6.51 (m, 2H, H-2″, 6′′), 6.34 (s, 1H, H-6), 3.63 (s, 3H, OCH3) ppm. 13C{1H} NMR (126 MHz, DMSO-d6) δ 176.1 (C-4), 160.3 (C-7), 157.0 (C-5), 151.7 (C-4″), 151.4 (C-9), 147.6 (C-4′), 146.7 (C-2), 144.7 (C-3′), 141.4 (C-1″), 135.6 (C-3), 122.0 (C-1′), 119.5 (C-6′), 115.8 (C-2′), 115.2 (C-5′), 114.5 (2C, C-2″,6′′), 114.4 (2C, C-3″,5″), 109.2 (C-8), 103.3 (C-10), 98.0 (C-6), 55.4 (OCH3) ppm. HRMS (ESI, m/z) calcd for C22H16O8N [M – H]− 422.08814, found 422.08784.
2-(3,4-Dihydroxyphenyl)-8-(anilino)-3,5,7-trihydroxy-4H–1-benzopyran-4-one (8-(Anilino) quercetin, 7)
A yellow solid (42.7 mg, 64%). 1H NMR (500 MHz, DMSO-d6) δ 12.41 (s, 1H, HO-5), 10.58 (s, 1H, HO-7), 9.56 (bs, 1H, HO-4′or HO-3′), 9.41 (s, 1H, HO-3), 9.07 (bs, 1H, HO-4′or HO-3′), 7.66 (d, J = 2.2 Hz, 1H, H-2′), 7.13–7.05 (m, 2H, H-3″, 5″), 6.92 (dd, J = 8.5, 2.2 Hz, 1H, H-6′), 6.64–6.54 (m, 4H, H-2″, 6″, 4″, 5′), 6.36 (s, 1H, H-6) ppm. 13C{1H} NMR (126 MHz, DMSO-d6) δ 176.6 (C-4), 161.1 (C-7), 157.8 (C-5), 151.2 (C-9), 148.0 (C-4′), 147.2 (C-2), 145.2 (C-3′), 136.1 (C-3), 129.2 (2C, C-3″, 5″), 122.5 (C-1′), 119.9 (C-6′), 117.5 (C-4″), 116.3 (C-2′), 115.7 (C-5′), 113.8 (2C, C-2″, 6″), 108.5 (C-8), 103.8 (C-10), 98.0 (C-6) ppm. HRMS (ESI, m/z) calcd for C21H14O7N [M – H]− 392.07758, found 392.07719.
2-(3,4-Dihydroxyphenyl)-8-(4-(trifluoromethyl)anilino)-3,5,7-trihydroxy-4H–1-benzopyran-4-one (8-(4-(Trifluoromethyl)anilino) quercetin, 8)
A yellow solid (64 mg, 41%). 1H NMR (500 MHz, DMSO-d6) δ 12.45 (s, 1H, HO-5), 10.79 (bs, 1H, HO-7), 9.58 (bs, 1H, HO-4′), 9.46 (bs, 1H, HO-3), 9.10 (bs, 1H, HO-3′), 7.84 (bs, 1H, NH), 7.66 (d, J = 2.2 Hz, 1H, H-2′), 7.40 (dm, J = 8.5 Hz, 2H, H-3″, 5″), 6.86 (dd, J = 8.5, 2.2 Hz, 1H, H-6′), 6.68 (dm, J = 8.3 Hz, 2H, H-2″, 6″), 6.59 (d, J = 8.5 Hz, 1H, H-5′), 6.38 (s, 1H, H-6) ppm. 13C NMR{1H} (126 MHz, DMSO-d6) δ 176.1 (C-4), 160.6 (C-7), 157.9 (C-5), 151.6 (C-9), 150.8 (C-1″), 147.6 (C-3′), 146.8 (C-2), 144.8 (C-4′), 135.8 (C-3), 126.1 (q, J = 3.8 Hz, 2C, C-3″, 5″), 125.3 (q, J = 270.1 Hz, CF3), 121.9 (C-1′), 119.2 (C-6′), 116.7 (q, J = 31.8 Hz, C-4″), 115.8 (C-2′), 115.1 (C-5′), 112.8 (2C, C-2″, 6″), 106.5 (C-8), 103.3 (C-10), 98.2 (C-6) ppm. 19F NMR (470 MHz, DMSO-d6) δ −58.99 ppm. HRMS (ESI, m/z) calcd for C22H13O7NF3 [M – H]− 460.06496, found 460.06474.
2-(3,4-Dihydroxyphenyl)-8-(3-fluoroanilino)-3,5,7-trihydroxy-4H–1-benzopyran-4-one (8-(3-Fluoroanilino) quercetin, 17)
A yellow solid (80 mg, 40%). 1H NMR (500 MHz, DMSO-d6) δ 12.43 (s, 1H, HO-5), 10.70 (bs, 1H, HO-7), 9.59 (bs, 1H, HO-4′), 9.45 (bs, 1H, HO-3), 9.09 (bs, 1H. HO-3′), 7.65 (d, J = 2.2 Hz, 1H, H-2′), 7.46 (bs, 1H, NH), 7.08 (m, 1H, H-5″), 7.01 (dd, J = 8.5, 2.3 Hz, 1H, H-6′), 6.64 (d, J = 8.5 Hz, 1H, H-5′), 6.42–6.37 (m, 2H, H-4″, 6″), 6.36 (s, 1H, H-6), 6.29 (dt, J = 12.1, 2.4 Hz, 1H, H-2″) ppm. 13C{1H} NMR (126 MHz, DMSO-d6) δ 176.1 (C-4), 163.3 (d, J = 239.6 Hz, C-3″), 160.6 (C-7), 157.7 (C-5), 151.7 (C-9), 149.8 (d, J = 10.9 Hz, C-1″), 147.6 (C-4′), 146.7 (C-2), 144.8 (C-3′), 135.7 (C-3), 130.2 (d, J = 10.1 Hz, C-5″), 122.0 (C-1′), 119.3 (C-6′), 115.8 (C-2′), 115.2 (C-5′), 109.3 (C-6″), 107.2 (C-8), 103.3 (C-10), 103.1 (d, J = 21.4 Hz, C-4″), 99.6 (d, J = 25.2 Hz, C-2″), 98.1 (C-6) ppm. 19F NMR (470 MHz, DMSO-d6) δ −128.18 ppm. HRMS (ESI, m/z) calcd for C21H13O7NF [M – H]− 410.06815, found 410.06790.
2-(3,4-Dihydroxyphenyl)-8-(3,5-dimethoxyanilino)-3,5,7-trihydroxy-4H–1-benzopyran-4-one (8-(3,5-Dimethoxyanilino) quercetin, 9)
A yellow solid (41.4 mg, 27%). 1H NMR (500 MHz, DMSO-d6) δ 12.41 (s, 1H, HO-5), 10.57 (bs, 1H, HO-7), 9.60 (s, 1H, HO-4′), 9.42 (s, 1H, HO-3), 9.09 (s, 1H, HO-3′), 7.69 (d, J = 2.2 Hz, 1H, H-2′), 7.11 (bs, 1H, NH), 7.07 (dd, J = 8.5, 2.2 Hz, 1H, H-6′), 6.66 (d, J = 8.5 Hz, 1H, H-5′), 6.34 (s, 1H, H-6), 5.83 (tm, J = 2.2 Hz, 1H, H-4″), 5.76 (dm, J = 2.2 Hz, 2H, H-2″, 6″), 3.60 (s, 6H, OCH3) ppm. 13C{1H} NMR (126 MHz, DMSO-d6) δ 176.1 (C-4), 161.1 (2C, C-3″, 5″), 160.8 (C-7), 157.6 (C-5), 151.8 (C-9), 149.8 (C-1″), 147.6 (C-4′), 146.7 (C-2), 144.8 (C-3′), 135.7 (C-3), 122.1 (C-1′), 119.5 (C-6′), 115.9 (C-2′), 115.2(C-5′), 108.0 (C-8), 103.3 (C-10), 98.0 (C-6), 92.3 (2C, C-2″, 6″), 89.7 (C-4″), 54.8 (2C, OCH3) ppm. HRMS (ESI, m/z) calcd for C23H18O9N [M – H]− 452.09870, found 452.09827.
2-(3,4-Dihydroxyphenyl)-8-(4-fluoroanilino)-5,7-dihydroxy-4H–1-benzopyran-4-one (8-(4-Fluoroanilino) luteolin, 11)
A yellow solid (95 mg, 64%). 1H NMR (500 MHz, DMSO-d6) δ 12.89 (s, 1H, HO-5), 10.70 (bs, 1H), 9.89 (bs, 1H), 9.13 (bs, 1H) (HO-3′, HO-4′, HO-7), 7.15 (d, J = 2.3 Hz, 1H, 2′), 7.15 (bs, 1H, -NH), 7.00 (dd, J = 8.4, 2.3 Hz, 1H, H-6′), 6.92 (m, 2H, H-3″, 5″), 6.70 (d, J = 8.4 Hz, 1H, H-5′), 6.65 (s, 1H, H-3), 6.62–6.54 (m, 2H, H-2″, 6″), 6.36 (s, 1H, H-6) ppm. 13C{1H} NMR (126 MHz, DMSO-d6) δ 182.0 (C-4), 163.7 (C-2), 160.8 (C-7), 158.1 (C-5), 155.0 (d, J = 232.0 Hz, C-4″), 152.6 (C-9), 149.7 (C-4′), 145.6 (C-3′), 143.9 (d, J = 1.4 Hz, C-1″), 121.5 (C-1′), 118.8 (C-6′), 115.5 (C-5′), 115.1 (d, J = 22.4 Hz, 2C, C-3″, 5″), 114.2 (d, J = 7.5 Hz, 2C, C-2″, 6″), 113.7 (C-2′), 108.8 (C-8), 104.0 (C-10), 102.6 (C-3), 98.7 (C-6) ppm. 19F NMR (470 MHz, DMSO-d6) δ −128.2 ppm. HRMS (ESI, m/z) calcd for C21H13O6NF [M – H]− 394.07324, found 394.07290.
2-(3,4-Dihydroxyphenyl)-8-(4-methoxyanilino)-5,7-dihydroxy-4H–1-benzopyran-4-one (8-(4-Methoxyanilino) luteolin, 12)
A yellow solid (50 mg, 33%). 1H NMR (500 MHz, DMSO-d6) δ 12.86 (s, 1H, HO-5), 10.56 (bs, 1H), 9.97 (bs, 1H), 9.16 (bs, 1H) (OH-7, OH-3′, OH-4′), 7.17 (d, J = 2.3 Hz, 1H, H-2′), 6.94 (dd, J = 8.4, 2.3 Hz, 1H, H-6′), 6.81 (s, 1H, NH), 6.72 (m, 2H, H-3″, 5″), 6.68 (d, J = 8.4 Hz, 1H, H-5′), 6.63 (s, 1H, H-3), 6.56 (m, 2H, H-2″, 6″), 6.35 (s, 1H, H-6), 3.63 (s, 3H, OCH3) ppm. 13C{1H} NMR (126 MHz, DMSO-d6) δ 182.0 (C-4), 163.7 (C-2), 160.7 (C-7), 157.7 (C-5), 152.4 (C-9), 151.7 (C-4″), 149.7 (C-4′), 145.6 (C-3′), 141.3 (C-1″), 121.5 (C-1′), 118.9 (C-6′), 115.4 (C-5′), 114.6 (2C, C-2″, 6″), 114.4 (2C, C-3″, 5″), 113.7 (C-2′), 109.7 (C-8), 103.9 (C-10), 102.5 (C-3), 98.7 (C-6), 55.4 (OCH3) ppm. HRMS (ESI, m/z) calcd for C22H16O7N [M – H]− 406.09323, found 406.09286.
2-(3,4-Dihydroxyphenyl)-8-(anilino)-5,7-dihydroxy-4H–1-benzopyran-4-one (8-(Anilino) luteolin, 13)
A yellow solid (51.1 mg, 36%). 1H NMR (500 MHz, DMSO-d6) δ 12.89 (bs, 1H), 10.69 (bs, 1H), 9.97 (bs, 1H), 9.14 (bs, 1H) (OH-5, OH-7, OH-3′, OH-4′), 7.95 (bs, 1H, NH), 7.18 (d, J = 2.3 Hz, 1H, H-2′), 7.08 (m, 2H, H-3″, 5″), 6.96 (dd, J = 8.4, 2.3 Hz, 1H, H-6′), 6.68 (d, J = 8.4 Hz, 1H, H-5′), 6.64 (s, 1H, H-3), 6.62 (dm, 1H, H-4″), 6.59 (m, 2H, H-2″, 6″), 6.38 (s, 1H, H-6) ppm. 13C{1H} NMR (126 MHz, DMSO-d6) δ 182.0 (C-4), 163.8 (C-2), 161.0 (C-7), 158.1 (C-5), 152.8 (C-9), 149.7 (C-4′), 147.4 (C-1″), 145.6 (C-3′), 128.8 (2C, C-3″, 5″), 121.5 (C-1′), 118.8 (C-6′), 117.1 (C-4″), 115.5 (C-5′), 113.7 (C-2′), 113.3 (2C, C-2″, 6″), 108.6 (C-8), 103.9 (C-10), 102.5 (C-3), 98.7 (C-6) ppm. HRMS (ESI, m/z) calcd for C21H14O6N [M – H]− 376.08266, found 376.08234.
2-(3,4-Dihydroxyphenyl)-8-(4-(trifluoromethyl)anilino)-5,7-dihydroxy-4H–1-benzopyran-4-one (8-(4-(Trifluoromethyl)anilino) luteolin, 14)
Dark gray petals (85 mg, 51%). 1H NMR (500 MHz, DMSO-d6) δ 12.94 (bs, 1H, HO-5), 10.88 (bs, 1H, HO-7), 9.99 (bs, 1H, HO-4′), 9.16 (bs, 1H, HO-3′), 7.89 (s, 1H, NH), 7.45–7.37 (m, 2H, H-3″, 5″), 7.19 (d, J = 2.3 Hz, 1H, H-2′), 6.92 (dd, J = 8.4, 2.3 Hz, 1H, H-6′), 6.70 (m, 2H, H-2″, 6″), 6.67 (s, 2H, H-3) 6.67 (d, J = 8.4 Hz, H-5′), 6.39 (s, 1H, H-6) ppm. 13C{1H} NMR (126 MHz, DMSO-d6) δ 182.0 (C-4), 163.7 (C-2), 160.9 (C-7), 158.7 (C-5), 152.8 (C-9), 150.7 (C-1″), 149.8 (C-4′), 145.7 (C-3′), 126.2 (q, J = 3.9 Hz, 2C, C-3″, 5″), 125.3 (q, J = 270.0 Hz, CF3), 121.4 (C-1′), 118.7 (C-6′), 116.8 (q, J = 31.8 Hz, C-4″), 115.5 (C-5′), 113.7 (C-2′), 112.8 (2C, C-2″, 6″), 107.0 (C-8), 104.0 (C-10), 102.7 (C-3), 98.8 (C-6) ppm. 19F NMR (470 MHz, DMSO-d6) δ −59.00 ppm. HRMS (ESI, m/z) calcd for C22H13O6NF3 [M – H]− 444.07004, found 444.06974.
2-(3,4-Dihydroxyphenyl)-8-(3-fluoroanilino)-5,7-dihydroxy-4H–1-benzopyran-4-one (8-(3-Fluoroanilino) luteolin, 15)
A yellow solid (89 mg, 60%). 1H NMR (500 MHz, DMSO-d6) δ 12.92 (s, 1H, HO-5), 10.79 (bs, 1H), 9.99 (bs, 1H), 9.16 (bs, 1H) (HO-7, HO-3′, HO-4′), 7.51 (s, 1H, NH), 7.19 (d, J = 2.3 Hz, 1H, H-2′), 7.09 (dm, 1H, H-5″), 7.05 (dd, J = 8.4, 2.3 Hz, 1H, H-6′), 6.71 (d, J = 8.4 Hz, 1H, H-5′), 6.67 (s, 1H, H-3), 6.41 (m, 2H, H-4″, 6″), 6.37 (s, 1H, H-6), 6.31 (dm, J = 12.0, 2.3 Hz, 1H, H-2″) ppm. 13C{1H} NMR (126 MHz, DMSO-d6) δ 182.0 (C-4), 163.7 (C-2), 163.3 (d, J = 239.8 Hz, C-3″), 160.9 (C-7), 158.5 (C-5), 152.8 (C-9), 149.7 (C-4′), 149.7 (d, J = 10.9 Hz, C-1″), 145.7 (C-3′), 130.2 (d, J = 10.1 Hz, C-5″), 121.5 (C-1′), 118.8 (C-6′), 115.5 (C-5′), 113.7 (C-2′), 109.3 (d, J = 1.7 Hz, C-6″), 107.7 (C-8), 104.0 (C-10), 103.1 (d, J = 21.3 Hz, C-4″), 102.6 (C-3), 99.7 (d, J = 25.1 Hz, C-2″), 98.8 (C-6) ppm. 19F NMR (470 MHz, DMSO-d6) δ −113.71 ppm. HRMS (ESI, m/z) calcd for C21H15O6NF [M + H]+ 396.08779, found 396.08757.
2-(3,4-Dihydroxyphenyl)-8-(3,5-dimethoxyanilino)-5,7-dihydroxy-4H–1-benzopyran-4-one (8-(3,5-Dimethoxyanilino) luteolin, 16)
A brown solid (15 mg, 9%). 1H NMR (500 MHz, DMSO-d6) δ 12.89 (s, 1H, HO-5), 10.76 (s, 1H), 10.00 (s, 1H) 9.15 (s, 1H) (OH-7, OH-3′, OH-4′), 7.24 (d, J = 2.3 Hz, 1H, H-2′), 7.16 (s, 1H, NH), 7.09 (dd, J = 8.4, 2.3 Hz, 1H, H-6′), 6.73 (d, J = 8.4 Hz, 1H, H-5′), 6.65 (s, 1H, H-3), 6.35 (s, 1H, H-6), 5.83 (tm, J = 2.2 Hz, 1H, H-4″), 5.77 (dm, J = 2.1 Hz, 2H, H-2″, 6″), 3.61 (s, 6H, −CH3) ppm. 13C{1H} NMR (126 MHz, DMSO-d6) δ 182.0 (C-4), 163.7 (C-2), 161.1 (C-7), 161.1 (C-3″, 5″), 158.3 (C-5), 152.9 (C-9), 149.7 (C-1″), 149.7 (C-4′), 145.6 (C-3′), 121.5 (C-1′), 118.9 (C-6′), 115.5 (C-5′), 113.8 (C-2′), 108.5 (C-8), 103.9 (C-10), 102.6 (C-3), 98.7 (C-6), 92.3 (2C, C-2″,6″), 89.8 (C-4″), 54.8 (OCH3) ppm. HRMS (ESI, m/z) calcd for C23H18O8N [M – H]− 436.10379, found 436.10345.
Biological Activity
2,2′-Azobis(2-methylpropionamidine) dihydrochloride (AAPH); 2′,7′-dichlorofluorescin diacetate (DCFH-DA); antibiotic antimycotic solution; Cefotaxime; Colistin; Dulbecco’s Modified Eagle’s Medium (DMEM); Erythromycin; Fetal Bovine Serum (FBS); Griess reagent; l-glutamine; lipopolysaccharides from Escherichia coli O111:B4 (LPS); MEM medium (Eagle’s Minimum Essential Media, no phenol red); Mueller Hinton Broth (MH); phosphate buffer saline (PBS); resazurin sodium salt; and trypsin/EDTA solution were purchased from Sigma-Aldrich (St. Louis, Missouri, USA).
Cell Lines and Bacterial Strains
Murine macrophages (Raw, 264.7, Sigma-Aldrich), human keratinocytes (HaCaT, C0055C, Thermo Fisher Scientific, Waltham, MA, USA); human dermal fibroblasts (HDF, 106–05A, Sigma-Aldrich) were cultivated in DMEM supplemented with 10% FBS, 2 mM l-glutamine, and 1× antibiotic antimycotic solution. The cells were cultivated in a CO2 incubator (5% CO2, 37 °C, Thermo Fisher Scientific, Brno, Czech Republic) and passaged twice a week with trypsin/EDTA solution according to a standardized protocol (Table 6). The human cell cultures were periodically authenticated using short tandem repeat (STR) profiling and checked for mycoplasma presence.
Table 6. For the Genotypic Characterization of Staphylococcus aureus Strains, the Following Set of Primers and Methods was Used
| gene | primer sequence (5′–3′) |
|---|---|
| ermA | GAAGCGGTAAACCCCTCTGA |
| TCGCAAATCCCTTCTCAACGA | |
| ermB | CCGAACACTAGGGTTGCTCT |
| CATCTGTGGTATGGCGGGTA | |
| ermC | ATCGGCTCAGGAAAAGGGC |
| TTGGAAATTATCGTGATCAACAAGT | |
| msrA | GAAGACATGCGTGACGTTTCA |
| TCGTTCTTTCCCCACCACTC | |
| lmrS | ATACTTAGCGGCGATGGGGA |
| ATAAGTACGCCTGCACCCAT | |
| mphC | TGGACTGAAGCAACCCACTC |
| CGCCGATTCTCCTGATTCCA |
Bacterial strains originated from the General University Hospital (Prague, Czech Republic) and their phenotypical characterization determined by the disc diffusion method according to EUCAST was as follows:
MRSA 9 resistant to PEN, OXA, MET, ERY, CLI, GEN, CIP, CMP, TET, AMI, TOB
MRSA 3596 resistant to PEN, OXA, MET, ERY, CLI, GEN, CIP, TET, RIF, AMI, TOB
MRSA 331 resistant to PEN, OXA, MET, ERY, CLI, CIP, CMP
MSSA 2 resistant to PEN (methicillin-sensitive penicillin-resistant Staphylococcus aureus)
where the abbreviations refer to antibiotics as follows: penicillin (PEN), oxacillin (OXA), methicillin (MET), erythromycin (ERY), clindamycin (CLI), gentamicin (GEN), ciprofloxacin (CIP), chloramphenicol (CMP), tetracyclin (TET), rifampicin (RIF), amikacin (AMI), tobramycin (TOB).
Antibiotic-sensitive strain of S. aureus CCM 4223 was purchased from the Czech Collection of Microorganisms (CCM, Brno, Czech Republic).
The overnight culture was diluted in MH broth to the final concentration of 2 × 108 CFU/ml. Cell pellets were harvested by centrifugation (8000 × g, 5 min) and stored at −20 °C. Genomic DNA was isolated using PureLink Genomic DNA Mini Kit (Invitrogen, USA) with the addition of lysostaphin (100 mg/L) according to the manufacturer’s instructions. Likewise, plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, Germany) with the addition of lysostaphin (100 mg/L) according to the manufacturer’s instructions.
The presence of the investigated genes in DNA was verified using the polymerase chain reaction (CFX96 Real-Time PCR Detection System, BIO-RAD, USA). The iQ SYBR Green Supermix was used in combination with the designed primers listed above. As part of the PCR method, mixtures of plasmid and genomic DNA were prepared for each strain. For the reaction itself, the starting concentration of the DNA mix was 1 μg/mL. The reaction was performed for each gene in duplicates. For each master mix, a nontemplate control was also measured, which had to be negative.
Cellular Antioxidant Capacity
Cellular antioxidant capacity was evaluated as previously described. (31,39) Briefly, 100 μL of RAW 264.7 cells with a density corresponding to 1 × 106 cells/mL were split into 96-well plates. After 24 h, cells were washed with PBS, and DMEM supplemented with DCFH-DA (0.0125 mg/mL) was added to each well together with the tested samples in the concentration range of 1.5–200 μM. After 1 h incubation in a CO2 incubator, the medium was replaced with AAPH solution (0.16 mg/mL in PBS), and fluorescence was immediately recorded (ex./em. 485/540 nm) for 2 h in 5 min intervals.
Anti-Inflammatory Activity
The anti-inflammatory activity of the tested flavonoids was determined as the ability to reduce the production of nitric oxide (NO), tumor necrosis factor (TNF-α), and interleukin 6 (IL-6) by RAW 264.7 stimulated by LPS, as previously described. (39,40) Briefly, 1 × 106 cells/mL was seeded into the 96-well plate (100 μL/well). After 48 h, LPS (100 ng/mL) and the samples (3–100 μM) were added to the MEM medium. After 24 h, the medium was mixed with Griess reagent (0.04 g/mL) at a 1:1 ratio. The absorbance was measured after 15 min at 540 nm. Cell viability was determined using the resazurin assay.
To determine TNF-α levels, cells were precultivated with the tested compounds for 24 h. After 2 h of incubation with LPS, the medium was diluted 1:10 with ELISA diluent. To determine the level of IL-6, cells were cultivated for 6 h with LPS and the tested compounds. Cytokine production was determined using an uncoated ELISA performed according to the manufacturer’s instructions.
Cytotoxicity
100 μL of cell suspension containing 105 cells/mL was pipetted into a 96-well plate. After 24 h incubation, the tested compounds were added in the concentration range 12.5–200 μM. After 72 h incubation, the cell viability was tested by standard resazurin assay. (41) Briefly, the cells were washed with PBS and incubated with 100 μL of resazurin solution (0.025 mg/mL) for 2 h. The fluorescence was measured at a wavelength of 560 nm excitation/590 nm emission.
Susceptibility of Antibiotic-Resistant Bacteria
Sensitization of multidrug-resistant clinical bacterial strains was performed according to ref (15). Antibiotic cutoff concentration was chosen according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST, Clinical breakpoints–bacteria, ver. 11.0). The 200 μM concentration of the derivatives was chosen as the highest test concentration. The absorbance detected at 600 nm was then used to estimate the number of viable cells after 24 h of incubation at 37 °C and 120 rpm.
Ethidium Bromide Accumulation Assay
The accumulation assay was performed according to previously published methods with minor modifications. (15,42) Briefly, a bacterial culture of S. aureus MSSA 2 cultured overnight in the presence of colistin (4 mg/L) to induce oxidative stress and activate efflux system (34) was diluted in PBS to OD600 nm = 0.6. The suspension was centrifuged (13,000 × g; 3 min), resuspended in fresh PBS, and distributed into the wells of a black 96-well microtiter plate (ThermoFisher Scientific). Samples were diluted with EtBr solution (4 μg/mL). 50 μL of the mixture was added to 50 μL of the bacterial suspension. The reaction was monitored using SpectraMax iD5Multi-Mode Microplate Reader (ex/em = 530/600 nm) every 60 s for 60 min.
Molecular Docking Analyses
AutoDock Tools was also employed to generate the necessary grid for conducting molecular docking with VinaDock 1.2. (43) First, the search for the optimal binding pose focused on the region based on a priori knowledge, for exploring ligand–receptor interactions. Subsequently, blind molecular docking was performed to investigate optional pockets of potential interest.
The protein MLS_B (also known as ERM_B) was predicted using the artificial intelligence program AlphaFold. Following the studies by Lee et al., (44) the N-terminal portion (NTERM) was identified as the region of primary interest for the activities of proteins encoded by ERMs. The following approach was used to construct the spatial grid box the region of interest was identified between amino acids 8TQNF11, delimited within the region defined as the X-motif. Validation of this area was performed by docking the molecule S-adenosyl-l-methionine (SAM), and the results were subsequently compared with those obtained by cocrystallization of SAM with the MLS protein encoded by the ERM C gene (PDB: 1QAN).
For visualization purposes and to calculate the electron density function, PyMOL Molecular Graphics System, Version 2.0 by Schrödinger, LLC, was employed.
Statistical Analysis
Experiments were performed with the respective number of replicates indicated in each figure/table. MIC was determined as IC70. Both IC70 and IC50 values were calculated using the following nonlinear regression in the software GraphPad Prism:
Y= Bottom + (Top – Bottom)/(1 + ((Top – Bottom)/((Top + Baseline)/2 – Bottom) – 1) * (Absolute IC50/X) ^ HillSlope)
where IC70 was calculated by the transformation of best-fit parameters defined as X.
Data are presented as mean values of replicates with the standard error of the mean (SEM). Statistical significance was tested with a Students t-test.
Supporting Information
The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.4c04627.
- The results of optimization of Ullmann reaction, cellular antioxidant and anti-inflammatory activity, cytotoxicity, antibacterial activity, and molecular docking, 1H, 13C{1H} NMR data, HPLC, and HRMS analyses is available free of charge on the ACS Publications Web site (PDF)
Author Information
- Corresponding Author
- Martina Hurtová – Institute of Microbiology of the Czech Academy of Sciences, Vídeňská 1083, Prague 142 00, Czech Republic;
https://orcid.org/0000-0002-1470-4450; Email: martina.hurtova@biomed.cas.cz
- Martina Hurtová – Institute of Microbiology of the Czech Academy of Sciences, Vídeňská 1083, Prague 142 00, Czech Republic;
- Authors
- Daniela Brdová – Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, Technická 5, Prague 166 28, Czech Republic
- Bára Křížkovská – Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, Technická 5, Prague 166 28, Czech Republic
- Guglielmo Tedeschi – Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, Technická 5, Prague 166 28, Czech Republic;
https://orcid.org/0009-0000-9404-970X - Tomáš Nejedlý – Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, Technická 5, Prague 166 28, Czech Republic
- Ondřej Strnad – Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, Technická 5, Prague 166 28, Czech Republic
- Simona Dobiasová – Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, Technická 5, Prague 166 28, Czech Republic
- Zuzana Osifová – Institute of Organic Chemistry and Biochemistry of the Czech Academy of Sciences, Flemingovo nám. 542, Prague 160 00, Czech Republic
- Gabriela Kroneislová – Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, Technická 5, Prague 166 28, Czech Republic; Department of Clinical Microbiology and ATB Center, Institute of Medical Biochemistry and Laboratory Diagnostics of the General University Hospital and of The First Faculty of Medicine of Charles University, U Nemocnice 2, Prague 2 128 08, Czech Republic
- Jan Lipov – Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, Technická 5, Prague 166 28, Czech Republic;
https://orcid.org/0000-0002-3244-5827 - Kateřina Valentová – Institute of Microbiology of the Czech Academy of Sciences, Vídeňská 1083, Prague 142 00, Czech Republic;
https://orcid.org/0000-0002-7714-5350 - Jitka Viktorová – Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, Technická 5, Prague 166 28, Czech Republic
- Vladimír Křen – Institute of Microbiology of the Czech Academy of Sciences, Vídeňská 1083, Prague 142 00, Czech Republic;
https://orcid.org/0000-0002-1091-4020
- Author ContributionsThe manuscript was written through the contributions of all authors. All authors have approved the final version of the manuscript.
- FundingThe project was funded by the projects of the Ministry of Education, Sports, and Youth of the Czech Republic (MEYS) No. LUC23061 (COST Action CA21145 EURESTOP) and the project Talking microbes-understanding microbial interactions within One Health framework (CZ.02.01.01/00/22_008/0004597); Czech Science Foundation No. 21-00551S and by the National Institute of Virology and Bacteriology (Programme EXCELES, No. LX22NPO5103)─Funded by the EU─Next Generation EU. Computational resources were provided by the e-INFRA CZ project (ID: 90255) and ELIXIR-CZ project (ID: LM2023055), supported by MEYS.
- NotesThe authors declare no competing financial interest.
Acknowledgments
The authors gratefully acknowledge Prof. Josef Cvačka from the Institute of Organic Chemistry and Biochemistry of the Czech Academy of Sciences, Prague, for HRMS measurements. The graphical abstract was created with BioRender.com.
References
This article references 44 other publications.
- 1Bariwal, J.; Van der Eycken, E. C–N bond forming cross-coupling reactions: An overview. Chem. Soc. Rev. 2013, 42, 9283– 9303, DOI: 10.1039/c3cs60228a View
- 2Cho, S. H.; Kim, J. Y.; Kwak, J.; Chang, S. Recent advances in the transition metal-catalyzed twofold oxidative C–H bond activation strategy for C–C and C–N bond formation. Chem. Soc. Rev. 2011, 40, 5068– 5083, DOI: 10.1039/c1cs15082k View
- 3Ullmann, F. Ueber eine neue Bildungsweise von Diphenylaminderivaten. Ber. Dtsch. Chem. Ges. 1903, 36, 2382– 2384, DOI: 10.1002/cber.190303602174 View
- 4Goldberg, I. Ueber Phenylirungen bei Gegenwart von Kupfer als Katalysator. Ber. Dtsch. Chem. Ges. 1906, 39, 1691– 1692, DOI: 10.1002/cber.19060390298 View
- 5Ma, D.; Xia, C. CuI-catalyzed coupling reaction of β-amino acids or esters with aryl halides at temperature lower than that employed in the normal Ullmann reaction. Facile synthesis of SB-214857. Org. Lett. 2001, 3, 2583– 2586, DOI: 10.1021/ol016258r View
- 6Ma, D.; Cai, Q. Copper/amino acid catalyzed cross-couplings of aryl and vinyl halides with nucleophiles. Acc. Chem. Res. 2008, 41, 1450– 1460, DOI: 10.1021/ar8000298 View
- 7Guram, A. S.; Rennels, R. A.; Buchwald, S. L. A simple catalytic method for the conversion of aryl bromides to arylamines. Angew. Chem., Int. Ed.1995, 34, 1348– 1350, DOI: 10.1002/anie.199513481 View
- 8Louie, J.; Hartwig, J. F. Palladium-catalyzed synthesis of arylamines from aryl halides. Mechanistic studies lead to coupling in the absence of tin reagents. Tetrahedron Lett. 1995, 36, 3609– 3612, DOI: 10.1016/0040-4039(95)00605-C View
- 9Dorel, R.; Grugel, C. P.; Haydl, A. M. The Buchwald-Hartwig amination after 25 years. Angew. Chem., Int. Ed. 2019, 58, 17118– 17129, DOI: 10.1002/anie.201904795 View
- 10Chambers, C. S.; Viktorová, J.; Řehořová, K.; Biedermann, D.; Turková, L.; Macek, T.; Křen, V.; Valentová, K. Defying multidrug resistance! Modulation of related transporters by flavonoids and flavonolignans. J. Agric. Food Chem. 2020, 68, 1763– 1779, DOI: 10.1021/acs.jafc.9b00694 View
- 11Zima, V.; Radilová, K.; Kožíšek, M.; Albiñana, C. B.; Karlukova, E.; Brynda, J.; Fanfrlík, J.; Flieger, M.; Hodek, J.; Weber, J.Unraveling the anti-influenza effect of flavonoids: Experimental validation of luteolin and its congeners as potent influenza endonuclease inhibitors. Eur. J. Med. Chem.2020, 208, 112754, DOI: 10.1016/j.ejmech.2020.112754 View
- 12Naik, R. G.; Kattige, S. L.; Bhat, S. V.; Alreja, B.; de Souza, N. J.; Rupp, R. H. An antiinflammatory cum immunomodulatory piperidinylbenzopyranone from Dysoxylum binectariferum: Isolation, structure and total synthesis. Tetrahedron 1988, 44, 2081– 2086, DOI: 10.1016/S0040-4020(01)90352-7 View
- 13Kumara, P. M.; Soujanya, K. N.; Ravikanth, G.; Vasudeva, R.; Ganeshaiah, K. N.; Shaanker, R. U. Rohitukine, a chromone alkaloid and a precursor of flavopiridol, is produced by endophytic fungi isolated from Dysoxylum binectariferum Hook.f and Amoora rohituka (Roxb).Wight & Arn. Phytomedicine2014, 21, 541– 546, DOI: 10.1016/j.phymed.2013.09.019 View
- 14Nguyen, T. L. A.; Bhattacharya, D. Antimicrobial activity of quercetin: An approach to its mechanistic principle. Molecules 2022, 27, 2494, DOI: 10.3390/molecules27082494 View
- 15Holasová, K.; Křížkovská, B.; Hoang, L.; Dobiasová, S.; Lipov, J.; Macek, T.; Křen, V.; Valentová, K.; Ruml, T.; Viktorová, J. Flavonolignans from silymarin modulate antibiotic resistance and virulence in Staphylococcus aureus. Biomed. Pharmacother. 2022, 149, 112806, DOI: 10.1016/j.biopha.2022.112806 View
- 16da Silva, C. R.; de Andrade Neto, J. B.; de Sousa Campos, R.; Figueiredo, N. S.; Sampaio, L. S.; Magalhães, H. I. F.; Cavalcanti, B. C.; Gaspar, D. M.; de Andrade, G. M.; Lima, I. S. P.; de Barros Viana, G. S. Synergistic effect of the flavonoid catechin, quercetin, or epigallocatechin gallate with fluconazole induces apoptosis in Candida tropicalis resistant to fluconazole. Antimicrob. Agents Chemother. 2014, 58 (3), 1468– 1478, DOI: 10.1128/AAC.00651-13 View
- 17Pal, A.; Tripathi, A. Demonstration of bactericidal and synergistic activity of quercetin with Meropenem among pathogenic carbapenem resistant Escherichia coli and Klebsiella pneumoniae. Microb. Pathog. 2020, 143, 104120, DOI: 10.1016/j.micpath.2020.104120 View
- 18Siriwong, S.; Teethaisong, Y.; Thumanu, K.; Dunkhunthod, B.; Eumkeb, G. The synergy and mode of action of quercetin plus amoxicillin against amoxicillin-resistant Staphylococcus epidermidis. BMC Pharmacol. Toxicol. 2016, 17, 39, DOI: 10.1186/s40360-016-0083-8 View
- 19Vipin, C.; Saptami, K.; Fida, F.; Mujeeburahiman, M.; Rao, S. S.; Athmika Arun, A. B.; Arun, A. B.; Rekha, P. D. Potential synergistic activity of quercetin with antibiotics against multidrug-resistant clinical strains of Pseudomonas aeruginosa. PLoS One 2020, 15, e0241304 DOI: 10.1371/journal.pone.0241304 View
- 20Zhao, X.; Cui, X.; Yang, Y.; Zhu, L.; Li, L.; Kong, X. Synergistic effect of quercetin on antibacterial activity of florfenicol against Aeromonas hydrophila in vitro and in vivo. Antibiotics 2022, 11, 929, DOI: 10.3390/antibiotics11070929 View
- 21Odabaş Köse, E.; Koyuncu Özyurt, Ö.; Bilmen, S.; Er, H.; Kilit, C.; Aydemir, E. Quercetin: Synergistic interaction with antibiotics against colistin-resistant Acinetobacter baumannii. Antibiotics 2023, 12, 739, DOI: 10.3390/antibiotics12040739 View
- 22Kim, M. K.; Lee, T. G.; Jung, M.; Park, K. H.; Chong, Y. In vitro synergism and anti-biofilm activity of quercetin-pivaloxymethyl conjugate against Staphylococcus aureus and Enterococcus species. Chem. Pharm. Bull. 2018, 66, 1019– 1022, DOI: 10.1248/cpb.c18-00380 View
- 23Siriwong, S.; Thumanu, K.; Hengpratom, T.; Eumkeb, G. Synergy and mode of action of ceftazidime plus quercetin or luteolin on Streptococcus pyogenes. Evid. Based Complementary Altern. Med. 2015, 2015, 759459, DOI: 10.1155/2015/759459 View
- 24Amin, M. U.; Khurram, M.; Khattak, B.; Khan, J. Antibiotic additive and synergistic action of rutin, morin and quercetin against methicillin resistant Staphylococcus aureus. BMC Complement Altern. Med. 2015, 15, 59, DOI: 10.1186/s12906-015-0580-0 View
- 25Jing, S.; Kong, X.; Wang, L.; Wang, H.; Feng, J.; Wei, L.; Meng, Y.; Liu, C.; Chang, X.; Qu, Y.Quercetin reduces the virulence of S. aureus by targeting ClpP to protect mice from MRSA-induced lethal pneumonia. Microbiol. Spectr. 2022, 10, e0234021 DOI: 10.1128/spectrum.02340-21 View
- 26Hurtová, M.; Káňová, K.; Dobiasová, S.; Holasová, K.; Čáková, D.; Hoang, L.; Biedermann, D.; Kuzma, M.; Cvačka, J.; Křen, V.Selectively halogenated flavonolignans – Preparation and antibacterial activity. Int. J. Mol. Sci. 2022, 23, 15121, DOI: 10.3390/ijms232315121 View
- 27Hurtova, M.; Biedermann, D.; Osifova, Z.; Cvacka, J.; Valentova, K.; Kren, V. Preparation of Synthetic and Natural Derivatives of Flavonoids Using Suzuki–Miyaura Cross-Coupling Reaction. Molecules 2022, 27, 967, DOI: 10.3390/molecules27030967 View
- 28Fitzmaurice, R. J.; Etheridge, Z. C.; Jumel, E.; Woolfson, D. N.; Caddick, S. Microwave-enhanced palladium-catalyzed coupling reactions: A diversity-oriented synthesis approach to functionalized flavones. Chem. Commun. 2007, 38, 4814– 4816, DOI: 10.1039/B610734F View
- 29Pajtás, D.; Kónya, K.; Kiss-Szikszai, A.; Džubák, P.; Pethő, Z.; Varga, Z.; Panyi, G.; Patonay, T. Optimization of the synthesis of flavone–amino acid and flavone–dipeptide hybrids via Buchwald–Hartwig reaction. J. Org. Chem. 2017, 82, 4578– 4587, DOI: 10.1021/acs.joc.7b00124 View
- 30Vu, L. T. N.; Anh, L. T.; Cuc, N. T.; Nhiem, N. X.; Tai, B. H.; Van Kiem, P.; Litaudon, M.; Thach, T. D.; Van Minh, C.; Mai, H. D. T.Prenylated flavonoids and other constituents from Macaranga indica. Nat. Prod. Res. 2021, 35, 2123– 2130, DOI: 10.1080/14786419.2019.1662007 View
- 31Wolfe, K. L.; Liu, R. H. Cellular antioxidant activity (CAA) assay for assessing antioxidants, foods, and dietary supplements. J. Agric. Food Chem.2007, 55, 8896– 8907, DOI: 10.1021/jf0715166 View
- 32Cao, G.; Sofic, E.; Prior, R. L. Antioxidant and prooxidant behavior of flavonoids: Structure-activity relationships. Free Radic. Biol. Med. 1997, 22, 749– 760, DOI: 10.1016/S0891-5849(96)00351-6 View
- 33Patel, R. V.; Mistry, B. M.; Shinde, S. K.; Syed, R.; Singh, V.; Shin, H. S. Therapeutic potential of quercetin as a cardiovascular agent. Eur. J. Med. Chem. 2018, 155, 889– 904, DOI: 10.1016/j.ejmech.2018.06.053 View
- 34Yu, Z.; Zhu, Y.; Fu, J.; Qiu, J.; Yin, J. Enhanced NADH metabolism involves colistin-induced killing of Bacillus subtilis and Paenibacillus polymyxa. Molecules 2019, 24, 387, DOI: 10.3390/molecules24030387 View
- 35Goh, B. C.; Xiang, X.; Lescar, J.; Dedon, P. C. Crystal structure and functional analysis of mycobacterial erythromycin resistance methyltransferase Erm38 reveals its RNA-binding site. J. Biol. Chem. 2022, 298, 101571, DOI: 10.1016/j.jbc.2022.101571 View
- 36Schluckebier, G.; Zhong, P.; Stewart, K. D.; Kavanaugh, T. J.; Abad-Zapatero, C. The 2.2 Å structure of the rRNA methyltransferase ErmC′and its complexes with cofactor and cofactor analogs: Implications for the reaction mechanism. J. Mol. Biol. 1999, 289, 277– 291, DOI: 10.1006/jmbi.1999.2788 View
- 37Duran, N.; Ozer, B.; Duran, G. G.; Onlen, Y.; Demir, C. Antibiotic resistance genes & susceptibility patterns in staphylococci. Indian J. Med. Res.2012, 135, 389– 396 Google Scholar
- 38Szymanek-Majchrzak, K.; Mlynarczyk, A.; Kawecki, D.; Pacholczyk, M.; Durlik, M.; Deborska-Materkowska, D.; Paczek, L.; Mlynarczyk, G. Resistance to aminoglycosides of methicillin-resistant strains of Staphylococcus aureus, originating in the surgical and transplantation wards of the Warsaw Clinical Center─A retrospective analysis. Transplant. Proc. 2018, 50, 2170– 2175, DOI: 10.1016/j.transproceed.2018.02.158 View
- 39Viktorová, J.; Dobiasová, S.; Řehořová, K.; Biedermann, D.; Káňová, K.; Šeborová, K.; Václavíková, R.; Valentová, K.; Ruml, T.; Křen, V.Antioxidant, anti-inflammatory, and multidrug resistance modulation activity of silychristin derivatives. Antioxidants 2019, 8, 303, DOI: 10.3390/antiox8080303 View
- 40Tran, V. N.; Strnad, O.; Šuman, J.; Veverková, T.; Sukupová, A.; Cejnar, P.; Hynek, R.; Kronusová, O.; Šach, J.; Kaštánek, P.Cannabidiol nanoemulsion for eye treatment – Anti-inflammatory, wound healing activity and its bioavailability using in vitro human corneal substitute. Int. J. Pharm. 2023, 643, 123202, DOI: 10.1016/j.ijpharm.2023.123202 View
- 41Tran, V. N.; Viktorová, J.; Augustýnková, K.; Jelenová, N.; Dobiasová, S.; Řehořová, K.; Fenclová, M.; Stránská-Zachariášová, M.; Vítek, L.; Hajšlová, J.In silico and in vitro studies of mycotoxins and their cocktails; Their toxicity and its mitigation by silibinin pre-treatment. Toxins 2020, 12, 148, DOI: 10.3390/toxins12030148 View
- 42Křížkovská, B.; Hoang, L.; Brdová, D.; Klementová, K.; Szemerédi, N.; Loučková, A.; Kronusová, O.; Spengler, G.; Kaštánek, P.; Hajšlová, J.Modulation of the bacterial virulence and resistance by well-known European medicinal herbs. J. Ethnopharmacol. 2023, 312, 116484, DOI: 10.1016/j.jep.2023.116484 View
- 43Trott, O.; Olson, A. J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2010, 31, 455– 461, DOI: 10.1002/jcc.21334 View
- 44Lee, H. J.; Jhang, S. T.; Jin, H. J. Potential target site for inhibitors in MLS(B) antibiotic resistance. Antibiotics 2021, 10, 264, DOI: 10.3390/antibiotics10030264 View
Cited By
This article is cited by 1 publications.
- Daniela Brdová, Tomáš Ruml, Jitka Viktorová. Mechanism of staphylococcal resistance to clinically relevant antibiotics. Drug Resistance Updates 2024, 77 , 101147. https://doi.org/10.1016/j.drup.2024.101147